January 29, 2022

Human CCL13/MCP4 PicoKine ELISA Kit

Human CCL13/MCP4 PicoKine ELISA Kit 

To Order Contact us: pablo@congreso-inmunologia.com

Human CCL13/MCP4 ELISA Kit

LF-EK50919 1×96T
EUR 648

ELISA kit for Human CCL13/MCP4

EK5356 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CCL13/MCP4 in samples from serum, plasma, tissue homogenates and other biological fluids.

CCL13/MCP4 ELISA Kit (Human) (OKBB00442)

OKBB00442 96 Wells
EUR 505
Description: Description of target: Chemokine (C-C motif) ligand 13 (CCL13) is a small cytokine belonging to the CC chemokine family. Its gene is located on human chromosome 17 within a large cluster of other CC chemokines. CCL13 induces chemotaxis in monocytes, eosinophils, T lymphocytes, and basophils by binding cell surface G-protein linked chemokine receptors such as CCR2, CCR3 and CCR5. Activity of this chemokine has been implicated in allergic reactions such as asthma. CCL13 can be induced by the inflammatory cytokines interleukin-1 and TNF-α.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Anti-MCP4/CCL13 Antibody

PB9030 100ug/vial
EUR 294

Human Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx250194-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

DLR-MCP4-Hu-48T 48T
EUR 479
  • Should the Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Monocyte Chemotactic Protein 4 (MCP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

DLR-MCP4-Hu-96T 96T
EUR 621
  • Should the Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Monocyte Chemotactic Protein 4 (MCP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RDR-MCP4-Hu-48Tests 48 Tests
EUR 500

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RDR-MCP4-Hu-96Tests 96 Tests
EUR 692

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RD-MCP4-Hu-48Tests 48 Tests
EUR 478

Human Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RD-MCP4-Hu-96Tests 96 Tests
EUR 662

Rat Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx255806-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx359852-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx361614-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx362528-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx352880-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx356203-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Horse Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx575547-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx512230-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

DLR-MCP4-c-48T 48T
EUR 556
  • Should the Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Monocyte Chemotactic Protein 4 (MCP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

DLR-MCP4-c-96T 96T
EUR 728
  • Should the Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Monocyte Chemotactic Protein 4 (MCP4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RDR-MCP4-c-48Tests 48 Tests
EUR 591

Canine Monocyte Chemotactic Protein 4 (MCP4) ELISA Kit

RDR-MCP4-c-96Tests 96 Tests
EUR 823

Guinea pig Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx357697-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human MCP4 ELISA kit

55R-1979 96 tests
EUR 617
Description: ELISA Kit for detection of MCP4 in the research laboratory

CCL13 ELISA KIT|Human

EF000043 96 Tests
EUR 689

Human CCL13 ELISA Kit

STJ150538 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4/CCL13 in human serum, plasma and other biological fluids

Rat CCL13 ELISA Kit

STJ150385 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4 in Rat serum, plasma and other biological fluids

MCP4 protein

30R-2540 10 ug
EUR 302
Description: Purified recombinant Human MCP4 protein

MCP4 protein

30R-AM065 20 ug
EUR 273
Description: Purified recombinant Human MCP4 protein

MCP4 antibody

10R-M167A 500 ug
EUR 273
Description: Mouse monoclonal MCP4 antibody

MCP4 antibody

70R-MG003 50 ug
EUR 273
Description: Affinity purified Goat polyclonal MCP4 antibody

MCP4 antibody

70R-MR029 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal MCP4 antibody

anti-MCP4

YF-PA14547 50 ul
EUR 363
Description: Mouse polyclonal to MCP4

anti-MCP4

YF-PA14548 50 ug
EUR 363
Description: Mouse polyclonal to MCP4

anti-MCP4

YF-PA14549 100 ug
EUR 403
Description: Rabbit polyclonal to MCP4

anti-MCP4

YF-PA24671 50 ul
EUR 334
Description: Mouse polyclonal to MCP4

CCL13 Antibody

31051-100ul 100ul
EUR 252

CCL13 Antibody

31051-50ul 50ul
EUR 187

CCL13 antibody

70R-10495 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL13 antibody

CCL13 Antibody

1-CSB-PA08939A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL13 Antibody

1-CSB-PA937680
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL13 Antibody

1-CSB-PA908097
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

CCL13 Antibody

DF9911 200ul
EUR 304
Description: CCL13 Antibody detects endogenous levels of total CCL13.

CCL13 Antibody

1-CSB-PA218529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL13 siRNA

20-abx910755
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL13 Antibody

ABD9911 100 ug
EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human CCL13 shRNA Plasmid

20-abx954290
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCP-4/CCL13, Human

HY-P7245 50ug
EUR 533

MCP-4, CCL13, human

RC315-24 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Anti-MCP4 (S2)

YF-MA15360 100 ug
EUR 363
Description: Mouse monoclonal to MCP4

Human CCL13(Monocyte Chemotactic Protein 4) ELISA Kit

EH0056 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q99616
  • Alias: CCL13(Monocyte Chemotactic Protein 4)/MCP-4/C-C motif chemokine 13/chemokine(C-C motif) ligand 13/CKb10/MCP4/MCP-4Monocyte chemoattractant protein 4/MGC17134/NCC-1Monocyte chemotactic prote
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

CCL13 Blocking Peptide

33R-4671 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL13 antibody, catalog no. 70R-10495

CCL13 Blocking Peptide

DF9911-BP 1mg
EUR 195

CCL13 Conjugated Antibody

C31051 100ul
EUR 397

CCL13 cloning plasmid

CSB-CL858719HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 297
  • Sequence: atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtcc
  • Show more
Description: A cloning plasmid for the CCL13 gene.

CCL13 Rabbit pAb

A2853-100ul 100 ul
EUR 308

CCL13 Rabbit pAb

A2853-200ul 200 ul
EUR 459

CCL13 Rabbit pAb

A2853-20ul 20 ul Ask for price

CCL13 Rabbit pAb

A2853-50ul 50 ul
EUR 223

CCL13 Polyclonal Antibody

ABP58010-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of CCL13 from Human. This CCL13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100

CCL13 Polyclonal Antibody

ABP58010-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of CCL13 from Human. This CCL13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100

CCL13 Polyclonal Antibody

ABP58010-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of CCL13 from Human. This CCL13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL13 protein at amino acid sequence of 20-100

CCL13 Polyclonal Antibody

ES10264-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL13 Polyclonal Antibody

ES10264-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-CCL13 antibody

STJ22927 100 µl
EUR 277
Description: This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. This chemokine plays a role in accumulation of leukocytes during inflammation. It may also be involved in the recruitment of monocytes into the arterial wall during artherosclerosis.

Anti-CCL13 antibody

STJ191422 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL13

pENTR223-CCL13 vector

PVT11826 2 ug
EUR 304

Human ULBP1 PicoKine ELISA Kit

EK1685 96 wells
EUR 425
Description: For quantitative detection of human ULBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ULBP3 PicoKine ELISA Kit

EK1686 96 wells
EUR 425
Description: For quantitative detection of human ULBP3 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Klotho PicoKine ELISA Kit

EK1688 96 wells
EUR 425
Description: For quantitative detection of human Klotho in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human B2M PicoKine ELISA Kit

EK1691 96 wells
EUR 425
Description: For quantitative detection of human B2M in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.

Human Haptoglobin PicoKine ELISA Kit

EK1702 96 wells
EUR 455
Description: For quantitative detection of human Haptoglobin in cell culture supernates, serum and plasma (heparin, EDTA).

Human FGFBP1 PicoKine ELISA Kit

EK1706 96 wells
EUR 425
Description: For quantitative detection of human FGFBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PROS1 PicoKine ELISA Kit

EK1739 96 wells
EUR 425
Description: For quantitative detection of human PROS1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human ckmm PicoKine ELISA Kit

EK1751 96 wells
EUR 425
Description: For quantitative detection of human ckmm in cell culture supernates, serum and plasma (heparin, EDTA).

Human ROBO1 PicoKine ELISA Kit

EK1755 96 wells
EUR 425
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin).

Human Ki67 PicoKine ELISA Kit

EK1759 96 wells
EUR 455
Description: For quantitative detection of human Ki67 in cell culture supernates, serum and plasma (heparin, EDTA).

Human PAM PicoKine ELISA Kit

EK1765 96 wells
EUR 425
Description: For quantitative detection of human PAM in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human TINAGL1 PicoKine ELISA Kit

EK1766 96 wells
EUR 425
Description: For quantitative detection of human TINAGL1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human CPA1 PicoKine ELISA Kit

EK1770 96 wells
EUR 425
Description: For quantitative detection of human CPA1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human EphA1 PicoKine ELISA Kit

EK1796 96 wells
EUR 425
Description: For quantitative detection of human EphA1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EphA2 PicoKine ELISA Kit

EK1797 96 wells
EUR 425
Description: For quantitative detection of human EphA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD164 PicoKine ELISA Kit

EK1811 96 wells
EUR 425
Description: For quantitative detection of human CD164 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG1A PicoKine ELISA Kit

EK1812 96 wells
EUR 425
Description: For quantitative detection of human REG1A in cell culture supernates, serum and plasma (heparin).

Human CES1 PicoKine ELISA Kit

EK1813 96 wells
EUR 425
Description: For quantitative detection of human CES1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CES2 PicoKine ELISA Kit

EK1814 96 wells
EUR 425
Description: For quantitative detection of human CES2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human REG3A PicoKine ELISA Kit

EK1834 96 wells
EUR 425
Description: For quantitative detection of human REG3A in cell culture supernates, serum and plasma (heparin).

Human LYPD3 PicoKine ELISA Kit

EK1837 96 wells
EUR 425
Description: For quantitative detection of human LYPD3 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Human MANF PicoKine ELISA Kit

EK1845 96 wells
EUR 425
Description: For quantitative detection of human MANF in cell culture supernates, serum and plasma (heparin, EDTA).

Human CD200R1 PicoKine ELISA Kit

EK1850 96 wells
EUR 425
Description: For quantitative detection of human CD200R1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human EDAR PicoKine ELISA Kit

EK1851 96 wells
EUR 425
Description: For quantitative detection of human EDAR in cell culture supernates, serum and plasma (heparin, EDTA).

Human Brorin PicoKine ELISA Kit

EK1852 96 wells
EUR 425
Description: For quantitative detection of human Brorin in cell culture supernates, serum and plasma (heparin, EDTA).

Human EDA PicoKine ELISA Kit

EK1856 96 wells
EUR 425
Description: For quantitative detection of human EDA in cell culture supernates, serum and plasma (heparin, EDTA).

Human TSKU PicoKine ELISA Kit

EK1859 96 wells
EUR 425
Description: For quantitative detection of human TSKU in cell culture supernates, serum and plasma (heparin, EDTA).

Human CPA2 PicoKine ELISA Kit

EK1861 96 wells
EUR 425
Description: For quantitative detection of human CPA2 in cell culture supernates, serum and plasma (heparin, EDTA).

Human SEZ6L PicoKine ELISA Kit

EK1862 96 wells
EUR 425
Description: For quantitative detection of human SEZ6L in cell culture supernates, serum and plasma (heparin).

Human SLITRK1 PicoKine ELISA Kit

EK1866 96 wells
EUR 425
Description: For quantitative detection of human SLITRK1 in cell culture supernates, serum and plasma (heparin).

Human CCL13/MCP4 PicoKine ELISA Kit