November 24, 2020

Human CXCL6/GCP2 PicoKine ELISA Kit

Human CXCL6/GCP2 PicoKine ELISA Kit 

To Order Contact us: pablo@congreso-inmunologia.com

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
DLR-GCP2-Hu-96T 96T
EUR 488
  • Should the Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RD-GCP2-Hu-48Tests 48 Tests
EUR 369
Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RD-GCP2-Hu-96Tests 96 Tests
EUR 506
Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RDR-GCP2-Hu-48Tests 48 Tests
EUR 385
Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RDR-GCP2-Hu-96Tests 96 Tests
EUR 529
Human CXCL6 ELISA Kit
ELA-E1570h 96 Tests
EUR 824
CXCL6 ELISA KIT|Human
EF000085 96 Tests
EUR 689
Human GCP2 ELISA Kit
EHG0116 96Tests
EUR 521
CXCL6 ELISA Kit (Human) (OKAN04883)
OKAN04883 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL
CXCL6 ELISA Kit (Human) (OKBB00706)
OKBB00706 96 Wells
EUR 505
Description: Description of target: Chemokine(C-X-C motif) ligand 6(CXCL6) is a small cytokine belonging to the CXC chemokine family that is also known as granulocyte chemotactic protein 2(GCP-2). As its former name suggests, CXCL6 is a chemoattractant for neutrophilic granulocytes. It elicits its chemotactic effects by interacting with the chemokine receptors CXCR1 and CXCR2. The gene for CXCL6 is located on human chromosome 4 in a cluster with other CXC chemokine genes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
CXCL6 ELISA Kit (Human) (OKCD07498)
OKCD07498 96 Wells
EUR 648
Description: Description of target: CXCL6 is chemotactic for neutrophil granulocytes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL
CXCL6 ELISA Kit (Human) (OKEH03984)
OKEH03984 96 Wells
EUR 544
Description: Description of target: Chemotactic for neutrophil granulocytes. Signals through binding and activation of its receptors (CXCR1 and CXCR2). In addition to its chemotactic and angiogenic properties, it has strong antibacterial activity against Gram-positive and Gram-negative bacteria (90-fold-higher when compared to CXCL5 and CXCL7).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23 pg/mL
Goat GCP2 ELISA Kit
EGTG0116 96Tests
EUR 521
Canine GCP2 ELISA Kit
ECG0116 96Tests
EUR 521
Chicken GCP2 ELISA Kit
ECKG0116 96Tests
EUR 521
Bovine GCP2 ELISA Kit
EBG0116 96Tests
EUR 521
Anserini GCP2 ELISA Kit
EAG0116 96Tests
EUR 521
Porcine GCP2 ELISA Kit
EPG0116 96Tests
EUR 521
Rat GCP2 ELISA Kit
ERG0116 96Tests
EUR 521
Rabbit GCP2 ELISA Kit
ERTG0116 96Tests
EUR 521
Sheep GCP2 ELISA Kit
ESG0116 96Tests
EUR 521
Mouse GCP2 ELISA Kit
EMG0116 96Tests
EUR 521
Monkey GCP2 ELISA Kit
EMKG0116 96Tests
EUR 521
CXCL6 ELISA Kit (Rat) (OKCD06917)
OKCD06917 96 Wells
EUR 818
Description: Description of target: mouse homolog is a member of the CXC chemokine family, is a neutrophil chemoattractant and is rapidly induced in response to muscle injury.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL
CXCL6 Chemi-Luminescent ELISA Kit (Human) (OKCD03504)
OKCD03504 96 Wells
EUR 988
Description: Description of target: Chemotactic for neutrophil granulocytes. Signals through binding and activation of its receptors (CXCR1 and CXCR2). In addition to its chemotactic and angiogenic properties, it has strong antibacterial activity against Gram-positive and Gram-negative bacteria (90-fold-higher when compared to CXCL5 and CXCL7).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL
Guinea Pig GCP2 ELISA Kit
EGG0116 96Tests
EUR 521
GCP2 ELISA Kit (Rat) (OKCD04267)
OKCD04267 96 Wells
EUR 857
Description: Description of target: catalyzes the release of glutamate from acidic peptides including the neuropeptide N-acetyl-alpha-L-aspartyl-L-glutamate [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.8 pg/mL
CXCL6 siRNA
20-abx913256
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCL6 antibody
70R-7855 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL6 antibody
CXCL6 Antibody
43727-100ul 100ul
EUR 252
CXCL6 Antibody
1-CSB-PA06169A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL6. Recognizes CXCL6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Human CXCL6 shRNA Plasmid
20-abx954303
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GCP2 antibody
70R-GR017 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal GCP2 antibody
GCP2 antibody
22204-100ul 100ul
EUR 390
GCP2 antibody
70R-12661 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GCP2 antibody
anti-GCP2
YF-PA14564 100 ug
EUR 403
Description: Rabbit polyclonal to GCP2
anti-GCP2
YF-PA24676 50 ul
EUR 334
Description: Mouse polyclonal to GCP2
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
CXCL6 Conjugated Antibody
C43727 100ul
EUR 397
CXCL6 cloning plasmid
CSB-CL006251HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 345
  • Sequence: atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaa
  • Show more
Description: A cloning plasmid for the CXCL6 gene.
CXCL6 Polyclonal Antibody
A58702 100 µg
EUR 570.55
Description: fast delivery possible
CXCL6 Rabbit pAb
A16207-100ul 100 ul
EUR 308
CXCL6 Rabbit pAb
A16207-200ul 200 ul
EUR 459
CXCL6 Rabbit pAb
A16207-20ul 20 ul
EUR 183
CXCL6 Rabbit pAb
A16207-50ul 50 ul
EUR 223
CXCL6 Blocking Peptide
33R-3372 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL6 antibody, catalog no. 70R-7855
pCMV-SPORT6-CXCL6
PVT13840 2 ug
EUR 391
Anti-CXCL6 antibody
STJ118660 100 µl
EUR 277
Human ADAMTS4 PicoKine ELISA Kit
EK1372 96 wells
EUR 425
Description: For quantitative detection of human ADAMTS4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human ANGPTL3 PicoKine ELISA Kit
EK1374 96 wells
EUR 425
Description: For quantitative detection of human ANGPTL3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human TGFBR3 PicoKine ELISA Kit
EK1383 96 wells
EUR 425
Description: For quantitative detection of human TGFBR3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human LOXL2 PicoKine ELISA Kit
EK1391 96 wells
EUR 425
Description: For quantitative detection of human LOXL2 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).
Human Epiregulin PicoKine ELISA Kit
EK1394 96 wells
EUR 425
Description: For quantitative detection of human Epiregulin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human CD97 PicoKine ELISA Kit
EK1402 96 wells
EUR 425
Description: For quantitative detection of human CD97 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human COMT PicoKine ELISA Kit
EK1406 96 wells
EUR 425
Description: For quantitative detection of human COMT in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human NRCAM PicoKine ELISA Kit
EK1408 96 wells
EUR 425
Description: For quantitative detection of human NRCAM in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human CD5L PicoKine ELISA Kit
EK1413 96 wells
EUR 425
Description: For quantitative detection of activated human CD5L in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human CD44 PicoKine ELISA Kit
EK1418 96 wells
EUR 425
Description: For quantitative detection of human CD44 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Human CD47 PicoKine ELISA Kit
EK1421 96 wells
EUR 425
Description: For quantitative detection of human CD47 in cell culture supernates and serum.
Human CD28 PicoKine ELISA Kit
EK1429 96 wells
EUR 425
Description: For quantitative detection of human CD28 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human CXCL6/GCP2 PicoKine ELISA Kit