Human CXCL6/GCP2 PicoKine ELISA Kit

Human CXCL6/GCP2 PicoKine ELISA Kit 

To Order Contact us: pablo@congreso-inmunologia.com

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
DLR-GCP2-Hu-96T	DL Develop	96T	EUR 488
Should the Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RDR-GCP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 385

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RDR-GCP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 529

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RD-GCP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 369

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
RD-GCP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 506

Human CXCL6 ELISA Kit
ELA-E1570h	Lifescience Market	96 Tests	EUR 824

CXCL6 ELISA KIT|Human
EF000085	Lifescience Market	96 Tests	EUR 689

Human GCP2 ELISA Kit
EHG0116	Abclonal	96Tests	EUR 521

CXCL6 ELISA Kit (Human) (OKBB00706)
OKBB00706	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Chemokine(C-X-C motif) ligand 6(CXCL6) is a small cytokine belonging to the CXC chemokine family that is also known as granulocyte chemotactic protein 2(GCP-2). As its former name suggests, CXCL6 is a chemoattractant for neutrophilic granulocytes. It elicits its chemotactic effects by interacting with the chemokine receptors CXCR1 and CXCR2. The gene for CXCL6 is located on human chromosome 4 in a cluster with other CXC chemokine genes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CXCL6 ELISA Kit (Human) (OKEH03984)
OKEH03984	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: Chemotactic for neutrophil granulocytes. Signals through binding and activation of its receptors (CXCR1 and CXCR2). In addition to its chemotactic and angiogenic properties, it has strong antibacterial activity against Gram-positive and Gram-negative bacteria (90-fold-higher when compared to CXCL5 and CXCL7).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23 pg/mL

CXCL6 ELISA Kit (Human) (OKCD07498)
OKCD07498	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: CXCL6 is chemotactic for neutrophil granulocytes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

CXCL6 ELISA Kit (Human) (OKAN04883)
OKAN04883	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

Goat GCP2 ELISA Kit
EGTG0116	Abclonal	96Tests	EUR 521

Bovine GCP2 ELISA Kit
EBG0116	Abclonal	96Tests	EUR 521

Canine GCP2 ELISA Kit
ECG0116	Abclonal	96Tests	EUR 521

Chicken GCP2 ELISA Kit
ECKG0116	Abclonal	96Tests	EUR 521

Anserini GCP2 ELISA Kit
EAG0116	Abclonal	96Tests	EUR 521

Mouse GCP2 ELISA Kit
EMG0116	Abclonal	96Tests	EUR 521

Rat GCP2 ELISA Kit
ERG0116	Abclonal	96Tests	EUR 521

Sheep GCP2 ELISA Kit
ESG0116	Abclonal	96Tests	EUR 521

Rabbit GCP2 ELISA Kit
ERTG0116	Abclonal	96Tests	EUR 521

Monkey GCP2 ELISA Kit
EMKG0116	Abclonal	96Tests	EUR 521

Porcine GCP2 ELISA Kit
EPG0116	Abclonal	96Tests	EUR 521

CXCL6 ELISA Kit (Rat) (OKCD06917)
OKCD06917	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: mouse homolog is a member of the CXC chemokine family, is a neutrophil chemoattractant and is rapidly induced in response to muscle injury.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

CXCL6 Antibody
43727-100ul	SAB	100ul	EUR 252

CXCL6 Antibody
1-CSB-PA06169A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL6. Recognizes CXCL6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CXCL6 antibody
70R-7855	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CXCL6 antibody

CXCL6 siRNA
20-abx913256	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXCL6 Chemi-Luminescent ELISA Kit (Human) (OKCD03504)
OKCD03504	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Chemotactic for neutrophil granulocytes. Signals through binding and activation of its receptors (CXCR1 and CXCR2). In addition to its chemotactic and angiogenic properties, it has strong antibacterial activity against Gram-positive and Gram-negative bacteria (90-fold-higher when compared to CXCL5 and CXCL7).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL

Guinea Pig GCP2 ELISA Kit
EGG0116	Abclonal	96Tests	EUR 521

GCP2 ELISA Kit (Rat) (OKCD04267)
OKCD04267	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: catalyzes the release of glutamate from acidic peptides including the neuropeptide N-acetyl-alpha-L-aspartyl-L-glutamate [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.8 pg/mL

Human CXCL6 shRNA Plasmid
20-abx954303	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GCP2 antibody
22204-100ul	SAB	100ul	EUR 390

GCP2 antibody
70R-12661	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GCP2 antibody

GCP2 antibody
70R-GR017	Fitzgerald	50 ug	EUR 273
Description: Affinity purified Rabbit polyclonal GCP2 antibody

anti-GCP2
YF-PA14564	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GCP2

anti-GCP2
YF-PA24676	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GCP2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CXCL6 Rabbit pAb
A16207-100ul	Abclonal	100 ul	EUR 308

CXCL6 Rabbit pAb
A16207-200ul	Abclonal	200 ul	EUR 459

CXCL6 Rabbit pAb
A16207-20ul	Abclonal	20 ul	EUR 183

CXCL6 Rabbit pAb
A16207-50ul	Abclonal	50 ul	EUR 223

CXCL6 Blocking Peptide
33R-3372	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL6 antibody, catalog no. 70R-7855

CXCL6 Conjugated Antibody
C43727	SAB	100ul	EUR 397

CXCL6 cloning plasmid
CSB-CL006251HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 345 Sequence: atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaa Show more
Description: A cloning plasmid for the CXCL6 gene.

CXCL6 Polyclonal Antibody
A58702	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-CXCL6 antibody
STJ118660	St John's Laboratory	100 µl	EUR 277

pCMV-SPORT6-CXCL6
PVT13840	Lifescience Market	2 ug	EUR 391

GCP-2 (CXCL6), human recombinant
7153-10	Biovision		EUR 207

GCP-2 (CXCL6), human recombinant
7153-50	Biovision		EUR 675

CXCL6 ORF Vector (Human) (pORF)
ORF002820	ABM	1.0 ug DNA	EUR 95

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
20-abx151635	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
abx575452-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Granulocyte Chemotactic Protein 2 ELISA Kit (GCP2)
RK01449	Abclonal	96 Tests	EUR 521

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
SEB570Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3095.25
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulocyte Chemotactic Protein 2 (GCP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
SEB570Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 342.55
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulocyte Chemotactic Protein 2 (GCP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
SEB570Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 446.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulocyte Chemotactic Protein 2 (GCP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
SEB570Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1709.25
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulocyte Chemotactic Protein 2 (GCP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-As Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Granulocyte Chemotactic Protein 2 (GCP2) ELISA Kit
4-SEB570Hu	Cloud-Clone	EUR 3146.00 EUR 1660.00 EUR 447.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Granulocyte Chemotactic Protein 2 elisa. Alternative names of the recognized antigen: CXCL6 SCYB6 GCP2 CKA-3 Chemokine(C-X-C-Motif)ligand 6 Small Inducible Cytokine Subfamily B(Cys-X-Cys)Member 6 Chemokine alpha 3 Small-inducible Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulocyte Chemotactic Protein 2 (GCP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human ULBP1 PicoKine ELISA Kit
EK1685	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human ULBP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human CXCL6/GCP2 PicoKine ELISA Kit